ID: 991216887_991216899

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 991216887 991216899
Species Human (GRCh38) Human (GRCh38)
Location 5:64165961-64165983 5:64166003-64166025
Sequence CCGGCGGGTCGGAGTCGGGCGGG CGGAGGGACCTGGCCTCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135} {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!