ID: 991221157_991221161

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 991221157 991221161
Species Human (GRCh38) Human (GRCh38)
Location 5:64219846-64219868 5:64219875-64219897
Sequence CCAGTGTTTCATAGTGAAACTAC CTGGAGATGTGTTTGTTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 197} {0: 1, 1: 1, 2: 4, 3: 18, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!