ID: 991223080_991223087

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 991223080 991223087
Species Human (GRCh38) Human (GRCh38)
Location 5:64237877-64237899 5:64237912-64237934
Sequence CCATGTACAATGTACCTTTCTTC CTCCATGATTGCAAGTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 756} {0: 1, 1: 2, 2: 65, 3: 171, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!