ID: 991223081_991223087

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 991223081 991223087
Species Human (GRCh38) Human (GRCh38)
Location 5:64237891-64237913 5:64237912-64237934
Sequence CCTTTCTTCCCCTTTACCTTCCT CTCCATGATTGCAAGTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 100, 3: 924, 4: 4333} {0: 1, 1: 2, 2: 65, 3: 171, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!