ID: 991226658_991226661

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 991226658 991226661
Species Human (GRCh38) Human (GRCh38)
Location 5:64281304-64281326 5:64281338-64281360
Sequence CCTGATTGCTCTGGCTAGGACTT TTGACTAGGCATGATGAGAATGG
Strand - +
Off-target summary {0: 500, 1: 1485, 2: 2479, 3: 9378, 4: 9649} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!