ID: 991257765_991257768

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 991257765 991257768
Species Human (GRCh38) Human (GRCh38)
Location 5:64634040-64634062 5:64634056-64634078
Sequence CCACTGCAATGGGATCTTGCAGT TTGCAGTGTGGGAGAGAGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 43, 3: 126, 4: 576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!