ID: 991281773_991281779

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 991281773 991281779
Species Human (GRCh38) Human (GRCh38)
Location 5:64922906-64922928 5:64922922-64922944
Sequence CCTGGGCTGCGTGCTCTAACCCT TAACCCTGGGTGGCTGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 52, 3: 175, 4: 342} {0: 2, 1: 1, 2: 3, 3: 32, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!