ID: 991350732_991350738

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 991350732 991350738
Species Human (GRCh38) Human (GRCh38)
Location 5:65718180-65718202 5:65718230-65718252
Sequence CCGCATACTGACATTTTGGATCA CTGTGCATTAGCAGCATCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200} {0: 2, 1: 1, 2: 5, 3: 16, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!