ID: 991361955_991361957

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 991361955 991361957
Species Human (GRCh38) Human (GRCh38)
Location 5:65830172-65830194 5:65830202-65830224
Sequence CCACTTTTGTGCAAGTGGTTATA AGCCATTAGAAGAATGATGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!