ID: 991396468_991396473

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 991396468 991396473
Species Human (GRCh38) Human (GRCh38)
Location 5:66209498-66209520 5:66209518-66209540
Sequence CCCCTGAAGAAAATTTTTCAGTG GTGGCTTCCCAGTGCCCTCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!