ID: 991396469_991396485

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 991396469 991396485
Species Human (GRCh38) Human (GRCh38)
Location 5:66209499-66209521 5:66209551-66209573
Sequence CCCTGAAGAAAATTTTTCAGTGG GCTGGGGTGTGACATGCCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!