ID: 991405154_991405158

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 991405154 991405158
Species Human (GRCh38) Human (GRCh38)
Location 5:66294125-66294147 5:66294147-66294169
Sequence CCAGGACTTTGAGATGTTTCCTC CCAAGCAAAAAGCCTTCCACGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!