ID: 991405163_991405175

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 991405163 991405175
Species Human (GRCh38) Human (GRCh38)
Location 5:66294172-66294194 5:66294216-66294238
Sequence CCCGCTCAAGTCCTGGGCCTGCG GTCTTGGTGCTCAGGCCTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 19, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!