ID: 991406522_991406527

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 991406522 991406527
Species Human (GRCh38) Human (GRCh38)
Location 5:66305686-66305708 5:66305717-66305739
Sequence CCAAGTGAGAAATAAGAGGCAGT GAACTGAGGGACAGAGGGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 69, 4: 967}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!