ID: 991435265_991435268

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 991435265 991435268
Species Human (GRCh38) Human (GRCh38)
Location 5:66591806-66591828 5:66591822-66591844
Sequence CCAGCTGCTAAGCTGTCTTTGTC CTTTGTCTCCTCAAGGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!