ID: 991456251_991456259

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 991456251 991456259
Species Human (GRCh38) Human (GRCh38)
Location 5:66807661-66807683 5:66807700-66807722
Sequence CCCACTTTCCCTGCATAGAGGAA CATGGGAACCGTAGGGCTAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!