ID: 991460914_991460917

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 991460914 991460917
Species Human (GRCh38) Human (GRCh38)
Location 5:66857368-66857390 5:66857417-66857439
Sequence CCATGTGTGGATTGCTTGCTGTC ATGCCAAGAAGCAGAATTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160} {0: 1, 1: 2, 2: 74, 3: 461, 4: 2150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!