ID: 991474270_991474276

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 991474270 991474276
Species Human (GRCh38) Human (GRCh38)
Location 5:67003473-67003495 5:67003501-67003523
Sequence CCCTCTTCCTTCTCTTTATCCTC TTTGTAAGCGAGTTTGTTCCTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 51, 3: 289, 4: 2381} {0: 1, 1: 0, 2: 2, 3: 5, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!