ID: 991484733_991484740

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 991484733 991484740
Species Human (GRCh38) Human (GRCh38)
Location 5:67123178-67123200 5:67123220-67123242
Sequence CCACTCACATCAGTGGCTCAGAG CCTCAAAAACTGGTGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 116, 4: 1090} {0: 1, 1: 0, 2: 1, 3: 16, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!