ID: 991500061_991500066

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 991500061 991500066
Species Human (GRCh38) Human (GRCh38)
Location 5:67268049-67268071 5:67268083-67268105
Sequence CCTTCTGGGAGGGAGGACCACGT AGCAGGAGGCTGTAGGTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110} {0: 1, 1: 0, 2: 4, 3: 35, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!