ID: 991568392_991568394

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 991568392 991568394
Species Human (GRCh38) Human (GRCh38)
Location 5:68029231-68029253 5:68029254-68029276
Sequence CCTCTTTAAGAGGGAGCAGCTTG TATCCTTAGAAGGACCACTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!