|
Left Crispr |
Right Crispr |
| Crispr ID |
991713130 |
991713133 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:69427822-69427844
|
5:69427850-69427872
|
| Sequence |
CCAATAGAGAACAGGTGCAGTGG |
GCCTGTAATCCGAGCACTTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 3, 3: 36, 4: 248} |
{0: 582, 1: 233618, 2: 278681, 3: 180060, 4: 136485} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|