ID: 991713130_991713136

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 991713130 991713136
Species Human (GRCh38) Human (GRCh38)
Location 5:69427822-69427844 5:69427863-69427885
Sequence CCAATAGAGAACAGGTGCAGTGG GCACTTTGGGAAGCCAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 248} {0: 173, 1: 6072, 2: 73561, 3: 190765, 4: 233473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!