ID: 991748709_991748710

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 991748709 991748710
Species Human (GRCh38) Human (GRCh38)
Location 5:69775272-69775294 5:69775290-69775312
Sequence CCTTTATACTATGAGAGACTGAA CTGAATACACTAACAGACAATGG
Strand - +
Off-target summary No data {0: 5, 1: 0, 2: 5, 3: 34, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!