ID: 991825122_991825124

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 991825122 991825124
Species Human (GRCh38) Human (GRCh38)
Location 5:70614193-70614215 5:70614219-70614241
Sequence CCTCTAATTCTATGAGCTTTGCT AAAATAGTGAAGAATAGGAAAGG
Strand - +
Off-target summary No data {0: 7, 1: 1, 2: 8, 3: 97, 4: 808}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!