ID: 991911448_991911454

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 991911448 991911454
Species Human (GRCh38) Human (GRCh38)
Location 5:71566524-71566546 5:71566577-71566599
Sequence CCTCTTGGATTGATAGTATAGTA TTTTGGGTTTGCAGGCCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 83} {0: 2, 1: 1, 2: 29, 3: 158, 4: 635}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!