ID: 991945479_991945492

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 991945479 991945492
Species Human (GRCh38) Human (GRCh38)
Location 5:71894846-71894868 5:71894893-71894915
Sequence CCTTGCTAGTTCTGAGCCCCCAA AGGCAGTCCTGCTCTAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 174} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!