ID: 991964160_991964170 |
View in Genome Browser |
Spacer: 22 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 991964160 | 991964170 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:72074382-72074404 | 5:72074427-72074449 |
Sequence | CCTTCCTTCCCTTGCTTATTCAG | AGCAGCTGGAGTTGGTGAACTGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |