ID: 991982118_991982129

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 991982118 991982129
Species Human (GRCh38) Human (GRCh38)
Location 5:72243058-72243080 5:72243103-72243125
Sequence CCTGTGGCAACAGGCTTTACAGA GGGTAGACAGAGATGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 157} {0: 1, 1: 1, 2: 5, 3: 92, 4: 806}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!