|
Left Crispr |
Right Crispr |
| Crispr ID |
992045692 |
992045698 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:72886724-72886746
|
5:72886764-72886786
|
| Sequence |
CCGTCTCTCCTAAAAATCAGCTG |
CTGTAATCCCAGCTACTCAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 133, 3: 399, 4: 817} |
{0: 1253, 1: 3569, 2: 5710, 3: 6951, 4: 7179} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|