ID: 992067593_992067597

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 992067593 992067597
Species Human (GRCh38) Human (GRCh38)
Location 5:73121827-73121849 5:73121864-73121886
Sequence CCTTCATGGGACCATGGATGTGA TTTAAAAGTTTTCTTTCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121} {0: 1, 1: 0, 2: 10, 3: 133, 4: 1285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!