ID: 992103111_992103119

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 992103111 992103119
Species Human (GRCh38) Human (GRCh38)
Location 5:73426394-73426416 5:73426436-73426458
Sequence CCTCTATGTGGACAGGCACCACC AAAGAACCAAAAAAAAGCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 42, 3: 841, 4: 4717}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!