ID: 992106400_992106407

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 992106400 992106407
Species Human (GRCh38) Human (GRCh38)
Location 5:73451826-73451848 5:73451854-73451876
Sequence CCTCCTTAGGGGGATGAAGGCTG GACCTGGGGGCTCAGACTTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104} {0: 1, 1: 0, 2: 2, 3: 16, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!