ID: 992110306_992110310

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 992110306 992110310
Species Human (GRCh38) Human (GRCh38)
Location 5:73486611-73486633 5:73486651-73486673
Sequence CCTGCTTTGGCCTTACAAGTAGC AAACCAAAAATAAAATTCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 62, 3: 1277, 4: 13773} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!