ID: 992110892_992110895

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 992110892 992110895
Species Human (GRCh38) Human (GRCh38)
Location 5:73492367-73492389 5:73492384-73492406
Sequence CCACATGTTGGTTCTGGGGTCCA GGTCCATACTCAAGGGTCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!