ID: 992133696_992133703

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 992133696 992133703
Species Human (GRCh38) Human (GRCh38)
Location 5:73721138-73721160 5:73721173-73721195
Sequence CCCTTTGGCCTGGAAGAGCAGGG GCTGCTCTCCACCATGTATGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 29, 4: 215} {0: 1, 1: 0, 2: 3, 3: 7, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!