ID: 992164042_992164048

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 992164042 992164048
Species Human (GRCh38) Human (GRCh38)
Location 5:74031092-74031114 5:74031143-74031165
Sequence CCACCGGGGCTGCTTTTGTTGGT TACCGCCTTTGATCAGACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118} {0: 1, 1: 0, 2: 0, 3: 0, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!