ID: 992173424_992173427

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 992173424 992173427
Species Human (GRCh38) Human (GRCh38)
Location 5:74126151-74126173 5:74126168-74126190
Sequence CCTAGATCACTCAAATTTCATGA TCATGACACAGTCGGAAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!