ID: 992243785_992243791

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 992243785 992243791
Species Human (GRCh38) Human (GRCh38)
Location 5:74796689-74796711 5:74796728-74796750
Sequence CCACAGCGCCCAGCCTGAATCTT TCATTTATACTGAAGGACCATGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 100, 3: 905, 4: 5360} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!