|
Left Crispr |
Right Crispr |
| Crispr ID |
992243787 |
992243791 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:74796698-74796720
|
5:74796728-74796750
|
| Sequence |
CCAGCCTGAATCTTTTTTTTTTT |
TCATTTATACTGAAGGACCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 29, 2: 381, 3: 2893, 4: 22018} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|