ID: 992249765_992249769

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 992249765 992249769
Species Human (GRCh38) Human (GRCh38)
Location 5:74865854-74865876 5:74865878-74865900
Sequence CCCGCGGCGGAGGCGAGCGAAGA GGGCATTCCCTCACACAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75} {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!