ID: 992262785_992262794

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 992262785 992262794
Species Human (GRCh38) Human (GRCh38)
Location 5:74987550-74987572 5:74987573-74987595
Sequence CCCTCCTGCACTCCTCCCTCACA CCTTCTTTTCTGATGGCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 98, 4: 833} {0: 1, 1: 0, 2: 2, 3: 22, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!