ID: 992277804_992277810

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 992277804 992277810
Species Human (GRCh38) Human (GRCh38)
Location 5:75138967-75138989 5:75139018-75139040
Sequence CCTACCTGCTTTCATTCCTGTAA CCAAATGCTGATTGTTATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 287} {0: 1, 1: 0, 2: 0, 3: 22, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!