ID: 992301559_992301565

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 992301559 992301565
Species Human (GRCh38) Human (GRCh38)
Location 5:75387231-75387253 5:75387260-75387282
Sequence CCATGGCACTGGCAGTTCCTAGA GCCAAAGGTGCAGAGCAGGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 3, 3: 28, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!