ID: 992306626_992306633

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 992306626 992306633
Species Human (GRCh38) Human (GRCh38)
Location 5:75446891-75446913 5:75446910-75446932
Sequence CCTTCAAGTCTCCTAGAAATCAC TCACTACAGCCAGAGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177} {0: 1, 1: 2, 2: 7, 3: 39, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!