|
Left Crispr |
Right Crispr |
| Crispr ID |
992314606 |
992314612 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:75539583-75539605
|
5:75539627-75539649
|
| Sequence |
CCTACTAGGCTTCAGAGATACTC |
AATTTTTTTTTTATAGAGACAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 17, 1: 217, 2: 1885, 3: 11492, 4: 51150} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|