ID: 992358453_992358458

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 992358453 992358458
Species Human (GRCh38) Human (GRCh38)
Location 5:76010220-76010242 5:76010252-76010274
Sequence CCTAGGCTCTTCCCAGGATGCAG TAATTACGGGAGCCCAGCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!