ID: 992365692_992365695

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 992365692 992365695
Species Human (GRCh38) Human (GRCh38)
Location 5:76086873-76086895 5:76086890-76086912
Sequence CCCTCCTAATTAGGGACAGCAGT AGCAGTAGTATTTGCACTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!