ID: 992426361_992426370

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 992426361 992426370
Species Human (GRCh38) Human (GRCh38)
Location 5:76662110-76662132 5:76662158-76662180
Sequence CCAAAGCAAACCTCCATTCACAC CCTCACAGGGAGAAGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191} {0: 1, 1: 0, 2: 5, 3: 64, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!