ID: 992496776_992496782

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 992496776 992496782
Species Human (GRCh38) Human (GRCh38)
Location 5:77301421-77301443 5:77301441-77301463
Sequence CCACTTTCTCCCAACTTCATGTA GTAATGTTCAGGAGAAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 534} {0: 1, 1: 0, 2: 2, 3: 24, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!